pgem-t easy Search Results


91
Addgene inc rab7a
( A ) The endocytic recycling pathway during sheath initiation and loss. ( B ) Lateral images of oligodendrocytes in the early stages of the ensheathment process in the spinal cord of living larvae at 2.5 dpf labeled with sox10:mScarlet-CAAX (magenta) and expressing either myrf:eGFP-RAB5C , <t>myrf:eGFP-RAB7A</t> , or myrf:eGFP-RAB11A (green). White boxes outline immature sheaths with Rab+ endosomal puncta for each fusion protein. (Scale bar = 5 μm). ( C ) Top panels are grey inset images from the outlined regions in B. The bottom panels are 3D reconstructions of these insets (Membrane in magenta, endosomes in green). ( D ) Quantification of Rab+ endosomal puncta in immature sheaths. Number of puncta in each sheath was normalized by the length of the sheath. Rab5 n = 36 sheaths (9 ventral cells/2 dorsal cells/11 larvae), Rab11 n = 34 sheaths (8 ventral cells/2 dorsal cells/10 larvae), Rab7 n = 33 sheaths (9 ventral cells/2 dorsal cells/11 larvae). Dashed lines represent average values and error bars are SD. (See associated source data and supplementary video files). Figure 7—source data 1. Excel spreadsheet with the Rab5, -7, -11 localization data.
Rab7a, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rab7a/product/Addgene inc
Average 91 stars, based on 1 article reviews
rab7a - by Bioz Stars, 2026-05
91/100 stars
  Buy from Supplier

93
Addgene inc sequence based reagent pgem t easy backbone promega rrid addgene 122563 commercial assay
( A ) The endocytic recycling pathway during sheath initiation and loss. ( B ) Lateral images of oligodendrocytes in the early stages of the ensheathment process in the spinal cord of living larvae at 2.5 dpf labeled with sox10:mScarlet-CAAX (magenta) and expressing either myrf:eGFP-RAB5C , <t>myrf:eGFP-RAB7A</t> , or myrf:eGFP-RAB11A (green). White boxes outline immature sheaths with Rab+ endosomal puncta for each fusion protein. (Scale bar = 5 μm). ( C ) Top panels are grey inset images from the outlined regions in B. The bottom panels are 3D reconstructions of these insets (Membrane in magenta, endosomes in green). ( D ) Quantification of Rab+ endosomal puncta in immature sheaths. Number of puncta in each sheath was normalized by the length of the sheath. Rab5 n = 36 sheaths (9 ventral cells/2 dorsal cells/11 larvae), Rab11 n = 34 sheaths (8 ventral cells/2 dorsal cells/10 larvae), Rab7 n = 33 sheaths (9 ventral cells/2 dorsal cells/11 larvae). Dashed lines represent average values and error bars are SD. (See associated source data and supplementary video files). Figure 7—source data 1. Excel spreadsheet with the Rab5, -7, -11 localization data.
Sequence Based Reagent Pgem T Easy Backbone Promega Rrid Addgene 122563 Commercial Assay, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sequence based reagent pgem t easy backbone promega rrid addgene 122563 commercial assay/product/Addgene inc
Average 93 stars, based on 1 article reviews
sequence based reagent pgem t easy backbone promega rrid addgene 122563 commercial assay - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

90
Addgene inc mn pubchem cid
( A ) The endocytic recycling pathway during sheath initiation and loss. ( B ) Lateral images of oligodendrocytes in the early stages of the ensheathment process in the spinal cord of living larvae at 2.5 dpf labeled with sox10:mScarlet-CAAX (magenta) and expressing either myrf:eGFP-RAB5C , <t>myrf:eGFP-RAB7A</t> , or myrf:eGFP-RAB11A (green). White boxes outline immature sheaths with Rab+ endosomal puncta for each fusion protein. (Scale bar = 5 μm). ( C ) Top panels are grey inset images from the outlined regions in B. The bottom panels are 3D reconstructions of these insets (Membrane in magenta, endosomes in green). ( D ) Quantification of Rab+ endosomal puncta in immature sheaths. Number of puncta in each sheath was normalized by the length of the sheath. Rab5 n = 36 sheaths (9 ventral cells/2 dorsal cells/11 larvae), Rab11 n = 34 sheaths (8 ventral cells/2 dorsal cells/10 larvae), Rab7 n = 33 sheaths (9 ventral cells/2 dorsal cells/11 larvae). Dashed lines represent average values and error bars are SD. (See associated source data and supplementary video files). Figure 7—source data 1. Excel spreadsheet with the Rab5, -7, -11 localization data.
Mn Pubchem Cid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mn pubchem cid/product/Addgene inc
Average 90 stars, based on 1 article reviews
mn pubchem cid - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

91
Addgene inc rab5c 80518 rab7a 80522
( A ) The endocytic recycling pathway during sheath initiation and loss. ( B ) Lateral images of oligodendrocytes in the early stages of the ensheathment process in the spinal cord of living larvae at 2.5 dpf labeled with sox10:mScarlet-CAAX (magenta) and expressing either <t>myrf:eGFP-RAB5C</t> , <t>myrf:eGFP-RAB7A</t> , or <t>myrf:eGFP-RAB11A</t> (green). White boxes outline immature sheaths with Rab+ endosomal puncta for each fusion protein. (Scale bar = 5 μm). ( C ) Top panels are grey inset images from the outlined regions in B. The bottom panels are 3D reconstructions of these insets (Membrane in magenta, endosomes in green). ( D ) Quantification of Rab+ endosomal puncta in immature sheaths. Number of puncta in each sheath was normalized by the length of the sheath. Rab5 n = 36 sheaths (9 ventral cells/2 dorsal cells/11 larvae), Rab11 n = 34 sheaths (8 ventral cells/2 dorsal cells/10 larvae), Rab7 n = 33 sheaths (9 ventral cells/2 dorsal cells/11 larvae). Dashed lines represent average values and error bars are SD. (See associated source data and supplementary video files). Figure 7—source data 1. Excel spreadsheet with the Rab5, -7, -11 localization data.
Rab5c 80518 Rab7a 80522, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rab5c 80518 rab7a 80522/product/Addgene inc
Average 91 stars, based on 1 article reviews
rab5c 80518 rab7a 80522 - by Bioz Stars, 2026-05
91/100 stars
  Buy from Supplier

90
Addgene inc mdrl luc reporter construct
( A ) The endocytic recycling pathway during sheath initiation and loss. ( B ) Lateral images of oligodendrocytes in the early stages of the ensheathment process in the spinal cord of living larvae at 2.5 dpf labeled with sox10:mScarlet-CAAX (magenta) and expressing either <t>myrf:eGFP-RAB5C</t> , <t>myrf:eGFP-RAB7A</t> , or <t>myrf:eGFP-RAB11A</t> (green). White boxes outline immature sheaths with Rab+ endosomal puncta for each fusion protein. (Scale bar = 5 μm). ( C ) Top panels are grey inset images from the outlined regions in B. The bottom panels are 3D reconstructions of these insets (Membrane in magenta, endosomes in green). ( D ) Quantification of Rab+ endosomal puncta in immature sheaths. Number of puncta in each sheath was normalized by the length of the sheath. Rab5 n = 36 sheaths (9 ventral cells/2 dorsal cells/11 larvae), Rab11 n = 34 sheaths (8 ventral cells/2 dorsal cells/10 larvae), Rab7 n = 33 sheaths (9 ventral cells/2 dorsal cells/11 larvae). Dashed lines represent average values and error bars are SD. (See associated source data and supplementary video files). Figure 7—source data 1. Excel spreadsheet with the Rab5, -7, -11 localization data.
Mdrl Luc Reporter Construct, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mdrl luc reporter construct/product/Addgene inc
Average 90 stars, based on 1 article reviews
mdrl luc reporter construct - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

91
Addgene inc pgem t
( A ) The endocytic recycling pathway during sheath initiation and loss. ( B ) Lateral images of oligodendrocytes in the early stages of the ensheathment process in the spinal cord of living larvae at 2.5 dpf labeled with sox10:mScarlet-CAAX (magenta) and expressing either <t>myrf:eGFP-RAB5C</t> , <t>myrf:eGFP-RAB7A</t> , or <t>myrf:eGFP-RAB11A</t> (green). White boxes outline immature sheaths with Rab+ endosomal puncta for each fusion protein. (Scale bar = 5 μm). ( C ) Top panels are grey inset images from the outlined regions in B. The bottom panels are 3D reconstructions of these insets (Membrane in magenta, endosomes in green). ( D ) Quantification of Rab+ endosomal puncta in immature sheaths. Number of puncta in each sheath was normalized by the length of the sheath. Rab5 n = 36 sheaths (9 ventral cells/2 dorsal cells/11 larvae), Rab11 n = 34 sheaths (8 ventral cells/2 dorsal cells/10 larvae), Rab7 n = 33 sheaths (9 ventral cells/2 dorsal cells/11 larvae). Dashed lines represent average values and error bars are SD. (See associated source data and supplementary video files). Figure 7—source data 1. Excel spreadsheet with the Rab5, -7, -11 localization data.
Pgem T, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pgem t/product/Addgene inc
Average 91 stars, based on 1 article reviews
pgem t - by Bioz Stars, 2026-05
91/100 stars
  Buy from Supplier

92
Addgene inc ligation
( A ) The endocytic recycling pathway during sheath initiation and loss. ( B ) Lateral images of oligodendrocytes in the early stages of the ensheathment process in the spinal cord of living larvae at 2.5 dpf labeled with sox10:mScarlet-CAAX (magenta) and expressing either <t>myrf:eGFP-RAB5C</t> , <t>myrf:eGFP-RAB7A</t> , or <t>myrf:eGFP-RAB11A</t> (green). White boxes outline immature sheaths with Rab+ endosomal puncta for each fusion protein. (Scale bar = 5 μm). ( C ) Top panels are grey inset images from the outlined regions in B. The bottom panels are 3D reconstructions of these insets (Membrane in magenta, endosomes in green). ( D ) Quantification of Rab+ endosomal puncta in immature sheaths. Number of puncta in each sheath was normalized by the length of the sheath. Rab5 n = 36 sheaths (9 ventral cells/2 dorsal cells/11 larvae), Rab11 n = 34 sheaths (8 ventral cells/2 dorsal cells/10 larvae), Rab7 n = 33 sheaths (9 ventral cells/2 dorsal cells/11 larvae). Dashed lines represent average values and error bars are SD. (See associated source data and supplementary video files). Figure 7—source data 1. Excel spreadsheet with the Rab5, -7, -11 localization data.
Ligation, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ligation/product/Addgene inc
Average 92 stars, based on 1 article reviews
ligation - by Bioz Stars, 2026-05
92/100 stars
  Buy from Supplier

93
Addgene inc c20 plasmid
a Balb/c mice were vaccinated with the <t>C20</t> vaccine at days 0, 21, and 42 and challenged with CT26 cells on day 62. One week after the last immunization (day 49), mice were bled retro-orbitally to monitor T cell immune response against CT26-neoepitopes by intracellular staining. Panel describes CD8 and CD4 neoantigen-specific effector and central memory T cell responses measured by FC using the gating strategy depicted in Supplementary Fig. . The stimulation pool included the 15 peptides listed in Table . b The panel depicts CT26 tumor growth overtime of one out of two experiments performed. Five animals per group were utilized. Each symbol represents an individual sample with the error bars representing the s.e.m. Significance was determined using Mann–Whitney test (* p < 0,05).
C20 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/c20 plasmid/product/Addgene inc
Average 93 stars, based on 1 article reviews
c20 plasmid - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

91
Addgene inc rab6a coding sequence
a Balb/c mice were vaccinated with the <t>C20</t> vaccine at days 0, 21, and 42 and challenged with CT26 cells on day 62. One week after the last immunization (day 49), mice were bled retro-orbitally to monitor T cell immune response against CT26-neoepitopes by intracellular staining. Panel describes CD8 and CD4 neoantigen-specific effector and central memory T cell responses measured by FC using the gating strategy depicted in Supplementary Fig. . The stimulation pool included the 15 peptides listed in Table . b The panel depicts CT26 tumor growth overtime of one out of two experiments performed. Five animals per group were utilized. Each symbol represents an individual sample with the error bars representing the s.e.m. Significance was determined using Mann–Whitney test (* p < 0,05).
Rab6a Coding Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rab6a coding sequence/product/Addgene inc
Average 91 stars, based on 1 article reviews
rab6a coding sequence - by Bioz Stars, 2026-05
91/100 stars
  Buy from Supplier

91
Addgene inc rab11a zebrafish
( A ) The endocytic recycling pathway during sheath initiation and loss. ( B ) Lateral images of oligodendrocytes in the early stages of the ensheathment process in the spinal cord of living larvae at 2.5 dpf labeled with sox10:mScarlet-CAAX (magenta) and expressing either myrf:eGFP-RAB5C , myrf:eGFP-RAB7A , or <t>myrf:eGFP-RAB11A</t> (green). White boxes outline immature sheaths with Rab+ endosomal puncta for each fusion protein. (Scale bar = 5 μm). ( C ) Top panels are grey inset images from the outlined regions in B. The bottom panels are 3D reconstructions of these insets (Membrane in magenta, endosomes in green). ( D ) Quantification of Rab+ endosomal puncta in immature sheaths. Number of puncta in each sheath was normalized by the length of the sheath. Rab5 n = 36 sheaths (9 ventral cells/2 dorsal cells/11 larvae), Rab11 n = 34 sheaths (8 ventral cells/2 dorsal cells/10 larvae), Rab7 n = 33 sheaths (9 ventral cells/2 dorsal cells/11 larvae). Dashed lines represent average values and error bars are SD. (See associated source data and supplementary video files). Figure 7—source data 1. Excel spreadsheet with the Rab5, -7, -11 localization data.
Rab11a Zebrafish, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rab11a zebrafish/product/Addgene inc
Average 91 stars, based on 1 article reviews
rab11a zebrafish - by Bioz Stars, 2026-05
91/100 stars
  Buy from Supplier

92
Addgene inc cloning rab3c cds
Anterogradely transported RUSH-TrkB carriers are negative for Rab27B, <t>Rab3C,</t> Rab8A, and Rab11A (A–L) Neurons co-expressing RUSH-TrkB-GFP and labeled Rab proteins: (A–C) mRuby3-Rab27B, (D–F) mRuby3-Rab3C, (G–I) mRFP-Rab8A, and (J–L) mRFP-Rab11A. Neurons were live imaged in the soma area immediately after addition of biotin for 45 min at 1 frame/min (A, D, G, and J), and then we imaged for 5 min at 1 s/frame at the proximal axon during a time window of 45–90 min after addition of biotin (C, F, I, and L). Plots show RUSH-TrkB and Rab proteins intensities in the peri-nuclear Golgi region over time in representative neurons (B, E, H, and K). Kymographs of RUSH-TrkB-GFP and respective Rab proteins motility in individual axons (C, F, I, and L).
Cloning Rab3c Cds, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cloning rab3c cds/product/Addgene inc
Average 92 stars, based on 1 article reviews
cloning rab3c cds - by Bioz Stars, 2026-05
92/100 stars
  Buy from Supplier

90
Addgene inc pgem t easy plasmid
Anterogradely transported RUSH-TrkB carriers are negative for Rab27B, <t>Rab3C,</t> Rab8A, and Rab11A (A–L) Neurons co-expressing RUSH-TrkB-GFP and labeled Rab proteins: (A–C) mRuby3-Rab27B, (D–F) mRuby3-Rab3C, (G–I) mRFP-Rab8A, and (J–L) mRFP-Rab11A. Neurons were live imaged in the soma area immediately after addition of biotin for 45 min at 1 frame/min (A, D, G, and J), and then we imaged for 5 min at 1 s/frame at the proximal axon during a time window of 45–90 min after addition of biotin (C, F, I, and L). Plots show RUSH-TrkB and Rab proteins intensities in the peri-nuclear Golgi region over time in representative neurons (B, E, H, and K). Kymographs of RUSH-TrkB-GFP and respective Rab proteins motility in individual axons (C, F, I, and L).
Pgem T Easy Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pgem t easy plasmid/product/Addgene inc
Average 90 stars, based on 1 article reviews
pgem t easy plasmid - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

Image Search Results


( A ) The endocytic recycling pathway during sheath initiation and loss. ( B ) Lateral images of oligodendrocytes in the early stages of the ensheathment process in the spinal cord of living larvae at 2.5 dpf labeled with sox10:mScarlet-CAAX (magenta) and expressing either myrf:eGFP-RAB5C , myrf:eGFP-RAB7A , or myrf:eGFP-RAB11A (green). White boxes outline immature sheaths with Rab+ endosomal puncta for each fusion protein. (Scale bar = 5 μm). ( C ) Top panels are grey inset images from the outlined regions in B. The bottom panels are 3D reconstructions of these insets (Membrane in magenta, endosomes in green). ( D ) Quantification of Rab+ endosomal puncta in immature sheaths. Number of puncta in each sheath was normalized by the length of the sheath. Rab5 n = 36 sheaths (9 ventral cells/2 dorsal cells/11 larvae), Rab11 n = 34 sheaths (8 ventral cells/2 dorsal cells/10 larvae), Rab7 n = 33 sheaths (9 ventral cells/2 dorsal cells/11 larvae). Dashed lines represent average values and error bars are SD. (See associated source data and supplementary video files). Figure 7—source data 1. Excel spreadsheet with the Rab5, -7, -11 localization data.

Journal: eLife

Article Title: Early myelination involves the dynamic and repetitive ensheathment of axons which resolves through a low and consistent stabilization rate

doi: 10.7554/eLife.82111

Figure Lengend Snippet: ( A ) The endocytic recycling pathway during sheath initiation and loss. ( B ) Lateral images of oligodendrocytes in the early stages of the ensheathment process in the spinal cord of living larvae at 2.5 dpf labeled with sox10:mScarlet-CAAX (magenta) and expressing either myrf:eGFP-RAB5C , myrf:eGFP-RAB7A , or myrf:eGFP-RAB11A (green). White boxes outline immature sheaths with Rab+ endosomal puncta for each fusion protein. (Scale bar = 5 μm). ( C ) Top panels are grey inset images from the outlined regions in B. The bottom panels are 3D reconstructions of these insets (Membrane in magenta, endosomes in green). ( D ) Quantification of Rab+ endosomal puncta in immature sheaths. Number of puncta in each sheath was normalized by the length of the sheath. Rab5 n = 36 sheaths (9 ventral cells/2 dorsal cells/11 larvae), Rab11 n = 34 sheaths (8 ventral cells/2 dorsal cells/10 larvae), Rab7 n = 33 sheaths (9 ventral cells/2 dorsal cells/11 larvae). Dashed lines represent average values and error bars are SD. (See associated source data and supplementary video files). Figure 7—source data 1. Excel spreadsheet with the Rab5, -7, -11 localization data.

Article Snippet: Plasmids encoding the RAB5C , RAB7A , and RAB11A zebrafish coding sequences (Addgene, RAB5C =80518, RAB7A =80522, and RAB11A =80529) were sequenced, and the RAB7A and RAB11A sequences each had a point mutation ( D63G and Q166R, respectively) relative to the NCBI protein sequences ( RAB7A =NM_200928.1, RAB11A =NM_001007359.1) and relative to other previous work in zebrafish ( ).

Techniques: Labeling, Expressing, Membrane

( A ) Representative lateral images of ventral oligodendrocytes in the spinal cord of living larvae at 4 days post fertilization (dpf) labeled by sox10:eGFP-CAAX (green) and one of the following: myrf:tagRFP , myrf:tagRFP-RAB5C , myrf:tagRFP-rab5C S36N , myrf:tagRFP-RAB7A , myrf:tagRFP-rab7A T22N , and myrf:tagRFP-RAB11A , myrf:tagRFP-rab11A S25N (all in magenta). The image and data for the control is the same as for the ventral group in (scale bar = 5 μm). ( B ) Sheath number per cell. ( C ) Average sheath length per cell. ( D ) Total sheath length per cell ( myrf:tagRFP n=26 cells/26 larvae, myrf:tagRFP-RAB5C n=28 cells/28 larvae, myrf:tagRFP-rab5C S36N n=27 cells/27 larvae , myrf:tagRFP-RAB7A n=29 cells/29 larvae, myrf:tagRFP-rab7A T22N n=32 cells/32 larvae, and myrf:tagRFP-RAB11A n=30 cells/30 larvae, myrf:tagRFP-rab11A S25N n=27 cells/27 larvae). The dashed lines in each plot represent average values with all data points shown. Error bars are standard deviation. Global significance was determined using a Kruskal-Wallis test for B–D. This global p-value is shown for C since it was not significant. Post hoc multiple comparison tests were not performed for this analysis. Post hoc Dunn’s multiple comparison tests were performed to compare groups in B and D. We compared everything with the control group and compared each wild-type and associated mutant with each other. The different Rab groups were not compared with each other (see associated source data). Figure 8—source data 1. Excel spreadsheet with the sheath analysis data for the Rab5, -7, -11 dominant-negative mutants.

Journal: eLife

Article Title: Early myelination involves the dynamic and repetitive ensheathment of axons which resolves through a low and consistent stabilization rate

doi: 10.7554/eLife.82111

Figure Lengend Snippet: ( A ) Representative lateral images of ventral oligodendrocytes in the spinal cord of living larvae at 4 days post fertilization (dpf) labeled by sox10:eGFP-CAAX (green) and one of the following: myrf:tagRFP , myrf:tagRFP-RAB5C , myrf:tagRFP-rab5C S36N , myrf:tagRFP-RAB7A , myrf:tagRFP-rab7A T22N , and myrf:tagRFP-RAB11A , myrf:tagRFP-rab11A S25N (all in magenta). The image and data for the control is the same as for the ventral group in (scale bar = 5 μm). ( B ) Sheath number per cell. ( C ) Average sheath length per cell. ( D ) Total sheath length per cell ( myrf:tagRFP n=26 cells/26 larvae, myrf:tagRFP-RAB5C n=28 cells/28 larvae, myrf:tagRFP-rab5C S36N n=27 cells/27 larvae , myrf:tagRFP-RAB7A n=29 cells/29 larvae, myrf:tagRFP-rab7A T22N n=32 cells/32 larvae, and myrf:tagRFP-RAB11A n=30 cells/30 larvae, myrf:tagRFP-rab11A S25N n=27 cells/27 larvae). The dashed lines in each plot represent average values with all data points shown. Error bars are standard deviation. Global significance was determined using a Kruskal-Wallis test for B–D. This global p-value is shown for C since it was not significant. Post hoc multiple comparison tests were not performed for this analysis. Post hoc Dunn’s multiple comparison tests were performed to compare groups in B and D. We compared everything with the control group and compared each wild-type and associated mutant with each other. The different Rab groups were not compared with each other (see associated source data). Figure 8—source data 1. Excel spreadsheet with the sheath analysis data for the Rab5, -7, -11 dominant-negative mutants.

Article Snippet: Plasmids encoding the RAB5C , RAB7A , and RAB11A zebrafish coding sequences (Addgene, RAB5C =80518, RAB7A =80522, and RAB11A =80529) were sequenced, and the RAB7A and RAB11A sequences each had a point mutation ( D63G and Q166R, respectively) relative to the NCBI protein sequences ( RAB7A =NM_200928.1, RAB11A =NM_001007359.1) and relative to other previous work in zebrafish ( ).

Techniques: Labeling, Control, Standard Deviation, Comparison, Mutagenesis, Dominant Negative Mutation

Journal: eLife

Article Title: Early myelination involves the dynamic and repetitive ensheathment of axons which resolves through a low and consistent stabilization rate

doi: 10.7554/eLife.82111

Figure Lengend Snippet:

Article Snippet: Plasmids encoding the RAB5C , RAB7A , and RAB11A zebrafish coding sequences (Addgene, RAB5C =80518, RAB7A =80522, and RAB11A =80529) were sequenced, and the RAB7A and RAB11A sequences each had a point mutation ( D63G and Q166R, respectively) relative to the NCBI protein sequences ( RAB7A =NM_200928.1, RAB11A =NM_001007359.1) and relative to other previous work in zebrafish ( ).

Techniques: Plasmid Preparation, Membrane, Mutagenesis, Transgenic Assay, Expressing

( A ) The endocytic recycling pathway during sheath initiation and loss. ( B ) Lateral images of oligodendrocytes in the early stages of the ensheathment process in the spinal cord of living larvae at 2.5 dpf labeled with sox10:mScarlet-CAAX (magenta) and expressing either myrf:eGFP-RAB5C , myrf:eGFP-RAB7A , or myrf:eGFP-RAB11A (green). White boxes outline immature sheaths with Rab+ endosomal puncta for each fusion protein. (Scale bar = 5 μm). ( C ) Top panels are grey inset images from the outlined regions in B. The bottom panels are 3D reconstructions of these insets (Membrane in magenta, endosomes in green). ( D ) Quantification of Rab+ endosomal puncta in immature sheaths. Number of puncta in each sheath was normalized by the length of the sheath. Rab5 n = 36 sheaths (9 ventral cells/2 dorsal cells/11 larvae), Rab11 n = 34 sheaths (8 ventral cells/2 dorsal cells/10 larvae), Rab7 n = 33 sheaths (9 ventral cells/2 dorsal cells/11 larvae). Dashed lines represent average values and error bars are SD. (See associated source data and supplementary video files). Figure 7—source data 1. Excel spreadsheet with the Rab5, -7, -11 localization data.

Journal: eLife

Article Title: Early myelination involves the dynamic and repetitive ensheathment of axons which resolves through a low and consistent stabilization rate

doi: 10.7554/eLife.82111

Figure Lengend Snippet: ( A ) The endocytic recycling pathway during sheath initiation and loss. ( B ) Lateral images of oligodendrocytes in the early stages of the ensheathment process in the spinal cord of living larvae at 2.5 dpf labeled with sox10:mScarlet-CAAX (magenta) and expressing either myrf:eGFP-RAB5C , myrf:eGFP-RAB7A , or myrf:eGFP-RAB11A (green). White boxes outline immature sheaths with Rab+ endosomal puncta for each fusion protein. (Scale bar = 5 μm). ( C ) Top panels are grey inset images from the outlined regions in B. The bottom panels are 3D reconstructions of these insets (Membrane in magenta, endosomes in green). ( D ) Quantification of Rab+ endosomal puncta in immature sheaths. Number of puncta in each sheath was normalized by the length of the sheath. Rab5 n = 36 sheaths (9 ventral cells/2 dorsal cells/11 larvae), Rab11 n = 34 sheaths (8 ventral cells/2 dorsal cells/10 larvae), Rab7 n = 33 sheaths (9 ventral cells/2 dorsal cells/11 larvae). Dashed lines represent average values and error bars are SD. (See associated source data and supplementary video files). Figure 7—source data 1. Excel spreadsheet with the Rab5, -7, -11 localization data.

Article Snippet: Plasmids encoding the RAB5C , RAB7A , and RAB11A zebrafish coding sequences (Addgene, RAB5C =80518, RAB7A =80522, and RAB11A =80529) were sequenced, and the RAB7A and RAB11A sequences each had a point mutation ( D63G and Q166R, respectively) relative to the NCBI protein sequences ( RAB7A =NM_200928.1, RAB11A =NM_001007359.1) and relative to other previous work in zebrafish ( ).

Techniques: Labeling, Expressing, Membrane

( A ) Representative lateral images of ventral oligodendrocytes in the spinal cord of living larvae at 4 days post fertilization (dpf) labeled by sox10:eGFP-CAAX (green) and one of the following: myrf:tagRFP , myrf:tagRFP-RAB5C , myrf:tagRFP-rab5C S36N , myrf:tagRFP-RAB7A , myrf:tagRFP-rab7A T22N , and myrf:tagRFP-RAB11A , myrf:tagRFP-rab11A S25N (all in magenta). The image and data for the control is the same as for the ventral group in (scale bar = 5 μm). ( B ) Sheath number per cell. ( C ) Average sheath length per cell. ( D ) Total sheath length per cell ( myrf:tagRFP n=26 cells/26 larvae, myrf:tagRFP-RAB5C n=28 cells/28 larvae, myrf:tagRFP-rab5C S36N n=27 cells/27 larvae , myrf:tagRFP-RAB7A n=29 cells/29 larvae, myrf:tagRFP-rab7A T22N n=32 cells/32 larvae, and myrf:tagRFP-RAB11A n=30 cells/30 larvae, myrf:tagRFP-rab11A S25N n=27 cells/27 larvae). The dashed lines in each plot represent average values with all data points shown. Error bars are standard deviation. Global significance was determined using a Kruskal-Wallis test for B–D. This global p-value is shown for C since it was not significant. Post hoc multiple comparison tests were not performed for this analysis. Post hoc Dunn’s multiple comparison tests were performed to compare groups in B and D. We compared everything with the control group and compared each wild-type and associated mutant with each other. The different Rab groups were not compared with each other (see associated source data). Figure 8—source data 1. Excel spreadsheet with the sheath analysis data for the Rab5, -7, -11 dominant-negative mutants.

Journal: eLife

Article Title: Early myelination involves the dynamic and repetitive ensheathment of axons which resolves through a low and consistent stabilization rate

doi: 10.7554/eLife.82111

Figure Lengend Snippet: ( A ) Representative lateral images of ventral oligodendrocytes in the spinal cord of living larvae at 4 days post fertilization (dpf) labeled by sox10:eGFP-CAAX (green) and one of the following: myrf:tagRFP , myrf:tagRFP-RAB5C , myrf:tagRFP-rab5C S36N , myrf:tagRFP-RAB7A , myrf:tagRFP-rab7A T22N , and myrf:tagRFP-RAB11A , myrf:tagRFP-rab11A S25N (all in magenta). The image and data for the control is the same as for the ventral group in (scale bar = 5 μm). ( B ) Sheath number per cell. ( C ) Average sheath length per cell. ( D ) Total sheath length per cell ( myrf:tagRFP n=26 cells/26 larvae, myrf:tagRFP-RAB5C n=28 cells/28 larvae, myrf:tagRFP-rab5C S36N n=27 cells/27 larvae , myrf:tagRFP-RAB7A n=29 cells/29 larvae, myrf:tagRFP-rab7A T22N n=32 cells/32 larvae, and myrf:tagRFP-RAB11A n=30 cells/30 larvae, myrf:tagRFP-rab11A S25N n=27 cells/27 larvae). The dashed lines in each plot represent average values with all data points shown. Error bars are standard deviation. Global significance was determined using a Kruskal-Wallis test for B–D. This global p-value is shown for C since it was not significant. Post hoc multiple comparison tests were not performed for this analysis. Post hoc Dunn’s multiple comparison tests were performed to compare groups in B and D. We compared everything with the control group and compared each wild-type and associated mutant with each other. The different Rab groups were not compared with each other (see associated source data). Figure 8—source data 1. Excel spreadsheet with the sheath analysis data for the Rab5, -7, -11 dominant-negative mutants.

Article Snippet: Plasmids encoding the RAB5C , RAB7A , and RAB11A zebrafish coding sequences (Addgene, RAB5C =80518, RAB7A =80522, and RAB11A =80529) were sequenced, and the RAB7A and RAB11A sequences each had a point mutation ( D63G and Q166R, respectively) relative to the NCBI protein sequences ( RAB7A =NM_200928.1, RAB11A =NM_001007359.1) and relative to other previous work in zebrafish ( ).

Techniques: Labeling, Control, Standard Deviation, Comparison, Mutagenesis, Dominant Negative Mutation

( A ) Lateral images from the ventral spinal cord of living larvae labeled with sox10 : eGFP-CAAX (in green) and one of the following: myrf:tagRFP , myrf:tagRFP - RAB5C , myrf:tagRFP-rab5C S36N (all in magenta); and time-lapsed for 15 hours from 2.5-3dpf. The first panel is an image taken immediately before starting the time-lapse experiment. The subsequent panels are the same cells at the peak of sheath accumulation, at 3dpf, and at 4dpf. The images and data for the control are the same as for the ventral group in . (Scale bar = 5 μm). ( B ) Total ensheathment attempts per cell. ( C ) Peak sheath number per cell. ( D ) Sheath number at 3dpf per cell. ( E ) Final sheath number per cell at 4dpf. ( F ) Net sheaths lost from the peak to 4dpf. ( G ) Percent of sheaths stabilized during the accumulation phase (peak sheath number/total ensheathment attempts). (H) Percent of sheaths stabilized during the stabilization phase (final sheath number/peak sheath number). ( I ) Percent of total sheaths stabilized across both the accumulation and stabilization phases (final sheath number/total ensheathment attempts). ( J ) Simple linear regression comparing the total number of ensheathment attempts to the final sheath number at 4dpf for each cell. (control n=18 cells/18 larvae, wild-type Rab5 n=18 cells/18 larvae, Rab5DN n=18 cells/17 larvae). The dashed lines in each plot represent average values with all data points shown. The error bars are standard deviation. Significance was determined using global Kruskal-Wallis tests. These p-values are shown for B-D and G since they were not significant. Post hoc multiple comparisons tests were not performed for these analyses. Post hoc Dunn’s multiple comparisons tests were done for E, F, H, and I and the individual p-values are shown. ( J’ ) The slopes of the Rab5WT and Rab5DN regression lines from J were compared to the control in Graphpad by (two-tailed) testing the null hypothesis that the slopes are identical (the lines are parallel). P-values are shown in the table. (See associated source data and supplementary video files). Figure 9—source data 1. Excel spreadsheet with the summary data for the Rab5 dominant-negative mutant oligodendrocyte ensheathment dynamics experiment.

Journal: eLife

Article Title: Early myelination involves the dynamic and repetitive ensheathment of axons which resolves through a low and consistent stabilization rate

doi: 10.7554/eLife.82111

Figure Lengend Snippet: ( A ) Lateral images from the ventral spinal cord of living larvae labeled with sox10 : eGFP-CAAX (in green) and one of the following: myrf:tagRFP , myrf:tagRFP - RAB5C , myrf:tagRFP-rab5C S36N (all in magenta); and time-lapsed for 15 hours from 2.5-3dpf. The first panel is an image taken immediately before starting the time-lapse experiment. The subsequent panels are the same cells at the peak of sheath accumulation, at 3dpf, and at 4dpf. The images and data for the control are the same as for the ventral group in . (Scale bar = 5 μm). ( B ) Total ensheathment attempts per cell. ( C ) Peak sheath number per cell. ( D ) Sheath number at 3dpf per cell. ( E ) Final sheath number per cell at 4dpf. ( F ) Net sheaths lost from the peak to 4dpf. ( G ) Percent of sheaths stabilized during the accumulation phase (peak sheath number/total ensheathment attempts). (H) Percent of sheaths stabilized during the stabilization phase (final sheath number/peak sheath number). ( I ) Percent of total sheaths stabilized across both the accumulation and stabilization phases (final sheath number/total ensheathment attempts). ( J ) Simple linear regression comparing the total number of ensheathment attempts to the final sheath number at 4dpf for each cell. (control n=18 cells/18 larvae, wild-type Rab5 n=18 cells/18 larvae, Rab5DN n=18 cells/17 larvae). The dashed lines in each plot represent average values with all data points shown. The error bars are standard deviation. Significance was determined using global Kruskal-Wallis tests. These p-values are shown for B-D and G since they were not significant. Post hoc multiple comparisons tests were not performed for these analyses. Post hoc Dunn’s multiple comparisons tests were done for E, F, H, and I and the individual p-values are shown. ( J’ ) The slopes of the Rab5WT and Rab5DN regression lines from J were compared to the control in Graphpad by (two-tailed) testing the null hypothesis that the slopes are identical (the lines are parallel). P-values are shown in the table. (See associated source data and supplementary video files). Figure 9—source data 1. Excel spreadsheet with the summary data for the Rab5 dominant-negative mutant oligodendrocyte ensheathment dynamics experiment.

Article Snippet: Plasmids encoding the RAB5C , RAB7A , and RAB11A zebrafish coding sequences (Addgene, RAB5C =80518, RAB7A =80522, and RAB11A =80529) were sequenced, and the RAB7A and RAB11A sequences each had a point mutation ( D63G and Q166R, respectively) relative to the NCBI protein sequences ( RAB7A =NM_200928.1, RAB11A =NM_001007359.1) and relative to other previous work in zebrafish ( ).

Techniques: Labeling, Control, Standard Deviation, Two Tailed Test, Dominant Negative Mutation

Journal: eLife

Article Title: Early myelination involves the dynamic and repetitive ensheathment of axons which resolves through a low and consistent stabilization rate

doi: 10.7554/eLife.82111

Figure Lengend Snippet:

Article Snippet: Plasmids encoding the RAB5C , RAB7A , and RAB11A zebrafish coding sequences (Addgene, RAB5C =80518, RAB7A =80522, and RAB11A =80529) were sequenced, and the RAB7A and RAB11A sequences each had a point mutation ( D63G and Q166R, respectively) relative to the NCBI protein sequences ( RAB7A =NM_200928.1, RAB11A =NM_001007359.1) and relative to other previous work in zebrafish ( ).

Techniques: Plasmid Preparation, Membrane, Mutagenesis, Transgenic Assay, Expressing

a Balb/c mice were vaccinated with the C20 vaccine at days 0, 21, and 42 and challenged with CT26 cells on day 62. One week after the last immunization (day 49), mice were bled retro-orbitally to monitor T cell immune response against CT26-neoepitopes by intracellular staining. Panel describes CD8 and CD4 neoantigen-specific effector and central memory T cell responses measured by FC using the gating strategy depicted in Supplementary Fig. . The stimulation pool included the 15 peptides listed in Table . b The panel depicts CT26 tumor growth overtime of one out of two experiments performed. Five animals per group were utilized. Each symbol represents an individual sample with the error bars representing the s.e.m. Significance was determined using Mann–Whitney test (* p < 0,05).

Journal: NPJ Vaccines

Article Title: Neoantigen cancer vaccine augments anti-CTLA-4 efficacy

doi: 10.1038/s41541-022-00433-9

Figure Lengend Snippet: a Balb/c mice were vaccinated with the C20 vaccine at days 0, 21, and 42 and challenged with CT26 cells on day 62. One week after the last immunization (day 49), mice were bled retro-orbitally to monitor T cell immune response against CT26-neoepitopes by intracellular staining. Panel describes CD8 and CD4 neoantigen-specific effector and central memory T cell responses measured by FC using the gating strategy depicted in Supplementary Fig. . The stimulation pool included the 15 peptides listed in Table . b The panel depicts CT26 tumor growth overtime of one out of two experiments performed. Five animals per group were utilized. Each symbol represents an individual sample with the error bars representing the s.e.m. Significance was determined using Mann–Whitney test (* p < 0,05).

Article Snippet: M8 and C20 plasmid were deposited in Addgene data base (#80536).

Techniques: Staining, MANN-WHITNEY

Immunogenic neoantigens expressed by  C20  vaccine.

Journal: NPJ Vaccines

Article Title: Neoantigen cancer vaccine augments anti-CTLA-4 efficacy

doi: 10.1038/s41541-022-00433-9

Figure Lengend Snippet: Immunogenic neoantigens expressed by C20 vaccine.

Article Snippet: M8 and C20 plasmid were deposited in Addgene data base (#80536).

Techniques: Immunopeptidomics, Enzyme-linked Immunospot

a Balb/c mice were inoculated s.c. with CT26 cells and treated with C20 and ICI starting from day 2 as depicted in the experimental scheme. Tumor volume and survival curve. b , c Balb/c mice were inoculated s.c. with CT26 cells and treated with ICI and NCV according to the experimental scheme. b Tumor (50–100 mm 3 ) bearing mice were randomized at day 6 and treated with αCTLA-4 and vaccinated with C20 the day after. The treatment was repeated weekly as described in the scheme. b Tumor volume measurements and survival curve. This experiment was conducted only once ( C ) CT26 tumor growth in CD4 or CD8 depleted mice treated as in panel ( b ). This experiment was repeated twice with similar results. Six animals per group were utilized with the error bars representing the s.e.m. Significance was determined using Mann–Whitney and Log-rank (Mantel–Cox) test ** p < 0.01 *** p < 0.001.

Journal: NPJ Vaccines

Article Title: Neoantigen cancer vaccine augments anti-CTLA-4 efficacy

doi: 10.1038/s41541-022-00433-9

Figure Lengend Snippet: a Balb/c mice were inoculated s.c. with CT26 cells and treated with C20 and ICI starting from day 2 as depicted in the experimental scheme. Tumor volume and survival curve. b , c Balb/c mice were inoculated s.c. with CT26 cells and treated with ICI and NCV according to the experimental scheme. b Tumor (50–100 mm 3 ) bearing mice were randomized at day 6 and treated with αCTLA-4 and vaccinated with C20 the day after. The treatment was repeated weekly as described in the scheme. b Tumor volume measurements and survival curve. This experiment was conducted only once ( C ) CT26 tumor growth in CD4 or CD8 depleted mice treated as in panel ( b ). This experiment was repeated twice with similar results. Six animals per group were utilized with the error bars representing the s.e.m. Significance was determined using Mann–Whitney and Log-rank (Mantel–Cox) test ** p < 0.01 *** p < 0.001.

Article Snippet: M8 and C20 plasmid were deposited in Addgene data base (#80536).

Techniques: MANN-WHITNEY

( A ) The endocytic recycling pathway during sheath initiation and loss. ( B ) Lateral images of oligodendrocytes in the early stages of the ensheathment process in the spinal cord of living larvae at 2.5 dpf labeled with sox10:mScarlet-CAAX (magenta) and expressing either myrf:eGFP-RAB5C , myrf:eGFP-RAB7A , or myrf:eGFP-RAB11A (green). White boxes outline immature sheaths with Rab+ endosomal puncta for each fusion protein. (Scale bar = 5 μm). ( C ) Top panels are grey inset images from the outlined regions in B. The bottom panels are 3D reconstructions of these insets (Membrane in magenta, endosomes in green). ( D ) Quantification of Rab+ endosomal puncta in immature sheaths. Number of puncta in each sheath was normalized by the length of the sheath. Rab5 n = 36 sheaths (9 ventral cells/2 dorsal cells/11 larvae), Rab11 n = 34 sheaths (8 ventral cells/2 dorsal cells/10 larvae), Rab7 n = 33 sheaths (9 ventral cells/2 dorsal cells/11 larvae). Dashed lines represent average values and error bars are SD. (See associated source data and supplementary video files). Figure 7—source data 1. Excel spreadsheet with the Rab5, -7, -11 localization data.

Journal: eLife

Article Title: Early myelination involves the dynamic and repetitive ensheathment of axons which resolves through a low and consistent stabilization rate

doi: 10.7554/eLife.82111

Figure Lengend Snippet: ( A ) The endocytic recycling pathway during sheath initiation and loss. ( B ) Lateral images of oligodendrocytes in the early stages of the ensheathment process in the spinal cord of living larvae at 2.5 dpf labeled with sox10:mScarlet-CAAX (magenta) and expressing either myrf:eGFP-RAB5C , myrf:eGFP-RAB7A , or myrf:eGFP-RAB11A (green). White boxes outline immature sheaths with Rab+ endosomal puncta for each fusion protein. (Scale bar = 5 μm). ( C ) Top panels are grey inset images from the outlined regions in B. The bottom panels are 3D reconstructions of these insets (Membrane in magenta, endosomes in green). ( D ) Quantification of Rab+ endosomal puncta in immature sheaths. Number of puncta in each sheath was normalized by the length of the sheath. Rab5 n = 36 sheaths (9 ventral cells/2 dorsal cells/11 larvae), Rab11 n = 34 sheaths (8 ventral cells/2 dorsal cells/10 larvae), Rab7 n = 33 sheaths (9 ventral cells/2 dorsal cells/11 larvae). Dashed lines represent average values and error bars are SD. (See associated source data and supplementary video files). Figure 7—source data 1. Excel spreadsheet with the Rab5, -7, -11 localization data.

Article Snippet: Plasmids encoding the RAB5C , RAB7A , and RAB11A zebrafish coding sequences (Addgene, RAB5C =80518, RAB7A =80522, and RAB11A =80529) were sequenced, and the RAB7A and RAB11A sequences each had a point mutation ( D63G and Q166R, respectively) relative to the NCBI protein sequences ( RAB7A =NM_200928.1, RAB11A =NM_001007359.1) and relative to other previous work in zebrafish ( ).

Techniques: Labeling, Expressing, Membrane

( A ) Representative lateral images of ventral oligodendrocytes in the spinal cord of living larvae at 4 days post fertilization (dpf) labeled by sox10:eGFP-CAAX (green) and one of the following: myrf:tagRFP , myrf:tagRFP-RAB5C , myrf:tagRFP-rab5C S36N , myrf:tagRFP-RAB7A , myrf:tagRFP-rab7A T22N , and myrf:tagRFP-RAB11A , myrf:tagRFP-rab11A S25N (all in magenta). The image and data for the control is the same as for the ventral group in (scale bar = 5 μm). ( B ) Sheath number per cell. ( C ) Average sheath length per cell. ( D ) Total sheath length per cell ( myrf:tagRFP n=26 cells/26 larvae, myrf:tagRFP-RAB5C n=28 cells/28 larvae, myrf:tagRFP-rab5C S36N n=27 cells/27 larvae , myrf:tagRFP-RAB7A n=29 cells/29 larvae, myrf:tagRFP-rab7A T22N n=32 cells/32 larvae, and myrf:tagRFP-RAB11A n=30 cells/30 larvae, myrf:tagRFP-rab11A S25N n=27 cells/27 larvae). The dashed lines in each plot represent average values with all data points shown. Error bars are standard deviation. Global significance was determined using a Kruskal-Wallis test for B–D. This global p-value is shown for C since it was not significant. Post hoc multiple comparison tests were not performed for this analysis. Post hoc Dunn’s multiple comparison tests were performed to compare groups in B and D. We compared everything with the control group and compared each wild-type and associated mutant with each other. The different Rab groups were not compared with each other (see associated source data). Figure 8—source data 1. Excel spreadsheet with the sheath analysis data for the Rab5, -7, -11 dominant-negative mutants.

Journal: eLife

Article Title: Early myelination involves the dynamic and repetitive ensheathment of axons which resolves through a low and consistent stabilization rate

doi: 10.7554/eLife.82111

Figure Lengend Snippet: ( A ) Representative lateral images of ventral oligodendrocytes in the spinal cord of living larvae at 4 days post fertilization (dpf) labeled by sox10:eGFP-CAAX (green) and one of the following: myrf:tagRFP , myrf:tagRFP-RAB5C , myrf:tagRFP-rab5C S36N , myrf:tagRFP-RAB7A , myrf:tagRFP-rab7A T22N , and myrf:tagRFP-RAB11A , myrf:tagRFP-rab11A S25N (all in magenta). The image and data for the control is the same as for the ventral group in (scale bar = 5 μm). ( B ) Sheath number per cell. ( C ) Average sheath length per cell. ( D ) Total sheath length per cell ( myrf:tagRFP n=26 cells/26 larvae, myrf:tagRFP-RAB5C n=28 cells/28 larvae, myrf:tagRFP-rab5C S36N n=27 cells/27 larvae , myrf:tagRFP-RAB7A n=29 cells/29 larvae, myrf:tagRFP-rab7A T22N n=32 cells/32 larvae, and myrf:tagRFP-RAB11A n=30 cells/30 larvae, myrf:tagRFP-rab11A S25N n=27 cells/27 larvae). The dashed lines in each plot represent average values with all data points shown. Error bars are standard deviation. Global significance was determined using a Kruskal-Wallis test for B–D. This global p-value is shown for C since it was not significant. Post hoc multiple comparison tests were not performed for this analysis. Post hoc Dunn’s multiple comparison tests were performed to compare groups in B and D. We compared everything with the control group and compared each wild-type and associated mutant with each other. The different Rab groups were not compared with each other (see associated source data). Figure 8—source data 1. Excel spreadsheet with the sheath analysis data for the Rab5, -7, -11 dominant-negative mutants.

Article Snippet: Plasmids encoding the RAB5C , RAB7A , and RAB11A zebrafish coding sequences (Addgene, RAB5C =80518, RAB7A =80522, and RAB11A =80529) were sequenced, and the RAB7A and RAB11A sequences each had a point mutation ( D63G and Q166R, respectively) relative to the NCBI protein sequences ( RAB7A =NM_200928.1, RAB11A =NM_001007359.1) and relative to other previous work in zebrafish ( ).

Techniques: Labeling, Control, Standard Deviation, Comparison, Mutagenesis, Dominant Negative Mutation

Journal: eLife

Article Title: Early myelination involves the dynamic and repetitive ensheathment of axons which resolves through a low and consistent stabilization rate

doi: 10.7554/eLife.82111

Figure Lengend Snippet:

Article Snippet: Plasmids encoding the RAB5C , RAB7A , and RAB11A zebrafish coding sequences (Addgene, RAB5C =80518, RAB7A =80522, and RAB11A =80529) were sequenced, and the RAB7A and RAB11A sequences each had a point mutation ( D63G and Q166R, respectively) relative to the NCBI protein sequences ( RAB7A =NM_200928.1, RAB11A =NM_001007359.1) and relative to other previous work in zebrafish ( ).

Techniques: Plasmid Preparation, Membrane, Mutagenesis, Transgenic Assay, Expressing

Anterogradely transported RUSH-TrkB carriers are negative for Rab27B, Rab3C, Rab8A, and Rab11A (A–L) Neurons co-expressing RUSH-TrkB-GFP and labeled Rab proteins: (A–C) mRuby3-Rab27B, (D–F) mRuby3-Rab3C, (G–I) mRFP-Rab8A, and (J–L) mRFP-Rab11A. Neurons were live imaged in the soma area immediately after addition of biotin for 45 min at 1 frame/min (A, D, G, and J), and then we imaged for 5 min at 1 s/frame at the proximal axon during a time window of 45–90 min after addition of biotin (C, F, I, and L). Plots show RUSH-TrkB and Rab proteins intensities in the peri-nuclear Golgi region over time in representative neurons (B, E, H, and K). Kymographs of RUSH-TrkB-GFP and respective Rab proteins motility in individual axons (C, F, I, and L).

Journal: Developmental Cell

Article Title: Combined kinesin-1 and kinesin-3 activity drives axonal trafficking of TrkB receptors in Rab6 carriers

doi: 10.1016/j.devcel.2021.01.010

Figure Lengend Snippet: Anterogradely transported RUSH-TrkB carriers are negative for Rab27B, Rab3C, Rab8A, and Rab11A (A–L) Neurons co-expressing RUSH-TrkB-GFP and labeled Rab proteins: (A–C) mRuby3-Rab27B, (D–F) mRuby3-Rab3C, (G–I) mRFP-Rab8A, and (J–L) mRFP-Rab11A. Neurons were live imaged in the soma area immediately after addition of biotin for 45 min at 1 frame/min (A, D, G, and J), and then we imaged for 5 min at 1 s/frame at the proximal axon during a time window of 45–90 min after addition of biotin (C, F, I, and L). Plots show RUSH-TrkB and Rab proteins intensities in the peri-nuclear Golgi region over time in representative neurons (B, E, H, and K). Kymographs of RUSH-TrkB-GFP and respective Rab proteins motility in individual axons (C, F, I, and L).

Article Snippet: GFP-Rab6A and mCherry-Rab6A were previously cloned in-house by inserting human Rab6A CDS into pGW2-GFP and pGW2-mCherry (modified pGW1) backbones. mCherry-Rab6A-Q72L and mCherry-Rab6A-T27N were constructed by site-directed mutagenesis of mCherry-Rab6A using circular PCR with the following primers: Q72L-Fw: ACAGCAGGTCTAGAGCGGTTC, Q72L-Rev: GTCCCATAATTGCAATCGTAC, T27N-Fw: GTTGGAAAGAACTCTTTGATCACCAGATTCATGTATGACAG and T27N-Rev: GCTTTGCTCCCCCAGGAA. mRuby3-Rab3C and mRuby3-Rab27B were constructed by cloning Rab3C CDS (from in-house cloned GW1-GFP-Rab3C) and Rab27B CDS (from GFP-Rab27B, Addgene # 89447) into BglII/BamHI restricted mRuby3-Tubulin (Addgene # 74256); mRFP-Rab11A, mRFP-Rab8A was previously constructed in-house by inserting respective human Rab CDS into pGW1-mRFP backbone.

Techniques: Expressing, Labeling

Journal: Developmental Cell

Article Title: Combined kinesin-1 and kinesin-3 activity drives axonal trafficking of TrkB receptors in Rab6 carriers

doi: 10.1016/j.devcel.2021.01.010

Figure Lengend Snippet:

Article Snippet: GFP-Rab6A and mCherry-Rab6A were previously cloned in-house by inserting human Rab6A CDS into pGW2-GFP and pGW2-mCherry (modified pGW1) backbones. mCherry-Rab6A-Q72L and mCherry-Rab6A-T27N were constructed by site-directed mutagenesis of mCherry-Rab6A using circular PCR with the following primers: Q72L-Fw: ACAGCAGGTCTAGAGCGGTTC, Q72L-Rev: GTCCCATAATTGCAATCGTAC, T27N-Fw: GTTGGAAAGAACTCTTTGATCACCAGATTCATGTATGACAG and T27N-Rev: GCTTTGCTCCCCCAGGAA. mRuby3-Rab3C and mRuby3-Rab27B were constructed by cloning Rab3C CDS (from in-house cloned GW1-GFP-Rab3C) and Rab27B CDS (from GFP-Rab27B, Addgene # 89447) into BglII/BamHI restricted mRuby3-Tubulin (Addgene # 74256); mRFP-Rab11A, mRFP-Rab8A was previously constructed in-house by inserting respective human Rab CDS into pGW1-mRFP backbone.

Techniques: Recombinant, Derivative Assay, shRNA, Sequencing, Mutagenesis, Plasmid Preparation, Software